ID: 940498926

View in Genome Browser
Species Human (GRCh38)
Location 2:154470135-154470157
Sequence ATGTTAGATGGTAGAGGTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940498926_940498930 24 Left 940498926 2:154470135-154470157 CCCGTACCTCTACCATCTAACAT No data
Right 940498930 2:154470182-154470204 TCTAAGCATTTGAGAAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940498926 Original CRISPR ATGTTAGATGGTAGAGGTAC GGG (reversed) Intergenic
No off target data available for this crispr