ID: 940498927

View in Genome Browser
Species Human (GRCh38)
Location 2:154470136-154470158
Sequence CATGTTAGATGGTAGAGGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940498927_940498930 23 Left 940498927 2:154470136-154470158 CCGTACCTCTACCATCTAACATG No data
Right 940498930 2:154470182-154470204 TCTAAGCATTTGAGAAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940498927 Original CRISPR CATGTTAGATGGTAGAGGTA CGG (reversed) Intergenic
No off target data available for this crispr