ID: 940498928

View in Genome Browser
Species Human (GRCh38)
Location 2:154470141-154470163
Sequence GAAAACATGTTAGATGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940498928_940498930 18 Left 940498928 2:154470141-154470163 CCTCTACCATCTAACATGTTTTC No data
Right 940498930 2:154470182-154470204 TCTAAGCATTTGAGAAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940498928 Original CRISPR GAAAACATGTTAGATGGTAG AGG (reversed) Intergenic