ID: 940498929

View in Genome Browser
Species Human (GRCh38)
Location 2:154470147-154470169
Sequence TACTATGAAAACATGTTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940498929_940498930 12 Left 940498929 2:154470147-154470169 CCATCTAACATGTTTTCATAGTA No data
Right 940498930 2:154470182-154470204 TCTAAGCATTTGAGAAAGCATGG No data
940498929_940498931 27 Left 940498929 2:154470147-154470169 CCATCTAACATGTTTTCATAGTA No data
Right 940498931 2:154470197-154470219 AAGCATGGTTCAGTAAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940498929 Original CRISPR TACTATGAAAACATGTTAGA TGG (reversed) Intergenic
No off target data available for this crispr