ID: 940498930

View in Genome Browser
Species Human (GRCh38)
Location 2:154470182-154470204
Sequence TCTAAGCATTTGAGAAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940498924_940498930 28 Left 940498924 2:154470131-154470153 CCCTCCCGTACCTCTACCATCTA No data
Right 940498930 2:154470182-154470204 TCTAAGCATTTGAGAAAGCATGG No data
940498925_940498930 27 Left 940498925 2:154470132-154470154 CCTCCCGTACCTCTACCATCTAA No data
Right 940498930 2:154470182-154470204 TCTAAGCATTTGAGAAAGCATGG No data
940498928_940498930 18 Left 940498928 2:154470141-154470163 CCTCTACCATCTAACATGTTTTC No data
Right 940498930 2:154470182-154470204 TCTAAGCATTTGAGAAAGCATGG No data
940498929_940498930 12 Left 940498929 2:154470147-154470169 CCATCTAACATGTTTTCATAGTA No data
Right 940498930 2:154470182-154470204 TCTAAGCATTTGAGAAAGCATGG No data
940498926_940498930 24 Left 940498926 2:154470135-154470157 CCCGTACCTCTACCATCTAACAT No data
Right 940498930 2:154470182-154470204 TCTAAGCATTTGAGAAAGCATGG No data
940498927_940498930 23 Left 940498927 2:154470136-154470158 CCGTACCTCTACCATCTAACATG No data
Right 940498930 2:154470182-154470204 TCTAAGCATTTGAGAAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940498930 Original CRISPR TCTAAGCATTTGAGAAAGCA TGG Intergenic
No off target data available for this crispr