ID: 940500021

View in Genome Browser
Species Human (GRCh38)
Location 2:154482177-154482199
Sequence TATCAGAAATCTCCTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940500021_940500027 23 Left 940500021 2:154482177-154482199 CCTGCCACAGGAGATTTCTGATA No data
Right 940500027 2:154482223-154482245 CAGAAGATGGCTGGGCTTGGTGG No data
940500021_940500026 20 Left 940500021 2:154482177-154482199 CCTGCCACAGGAGATTTCTGATA No data
Right 940500026 2:154482220-154482242 ATGCAGAAGATGGCTGGGCTTGG No data
940500021_940500024 14 Left 940500021 2:154482177-154482199 CCTGCCACAGGAGATTTCTGATA No data
Right 940500024 2:154482214-154482236 ACTGAAATGCAGAAGATGGCTGG No data
940500021_940500025 15 Left 940500021 2:154482177-154482199 CCTGCCACAGGAGATTTCTGATA No data
Right 940500025 2:154482215-154482237 CTGAAATGCAGAAGATGGCTGGG No data
940500021_940500023 10 Left 940500021 2:154482177-154482199 CCTGCCACAGGAGATTTCTGATA No data
Right 940500023 2:154482210-154482232 AGTTACTGAAATGCAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940500021 Original CRISPR TATCAGAAATCTCCTGTGGC AGG (reversed) Intergenic
No off target data available for this crispr