ID: 940500024

View in Genome Browser
Species Human (GRCh38)
Location 2:154482214-154482236
Sequence ACTGAAATGCAGAAGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940500021_940500024 14 Left 940500021 2:154482177-154482199 CCTGCCACAGGAGATTTCTGATA No data
Right 940500024 2:154482214-154482236 ACTGAAATGCAGAAGATGGCTGG No data
940500022_940500024 10 Left 940500022 2:154482181-154482203 CCACAGGAGATTTCTGATAATTA No data
Right 940500024 2:154482214-154482236 ACTGAAATGCAGAAGATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940500024 Original CRISPR ACTGAAATGCAGAAGATGGC TGG Intergenic
No off target data available for this crispr