ID: 940502324 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:154508451-154508473 |
| Sequence | GCCGAGGCGGGCGGATCACG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 5 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940502324_940502332 | 1 | Left | 940502324 | 2:154508451-154508473 | CCTCGTGATCCGCCCGCCTCGGC | No data | ||
| Right | 940502332 | 2:154508475-154508497 | TCCCAAAGTACTGGGATTACAGG | No data | ||||
| 940502324_940502336 | 24 | Left | 940502324 | 2:154508451-154508473 | CCTCGTGATCCGCCCGCCTCGGC | No data | ||
| Right | 940502336 | 2:154508498-154508520 | CATGAGCCACCGTGCCCGGCCGG | No data | ||||
| 940502324_940502328 | -8 | Left | 940502324 | 2:154508451-154508473 | CCTCGTGATCCGCCCGCCTCGGC | No data | ||
| Right | 940502328 | 2:154508466-154508488 | GCCTCGGCCTCCCAAAGTACTGG | No data | ||||
| 940502324_940502335 | 20 | Left | 940502324 | 2:154508451-154508473 | CCTCGTGATCCGCCCGCCTCGGC | No data | ||
| Right | 940502335 | 2:154508494-154508516 | CAGGCATGAGCCACCGTGCCCGG | No data | ||||
| 940502324_940502330 | -7 | Left | 940502324 | 2:154508451-154508473 | CCTCGTGATCCGCCCGCCTCGGC | No data | ||
| Right | 940502330 | 2:154508467-154508489 | CCTCGGCCTCCCAAAGTACTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940502324 | Original CRISPR | GCCGAGGCGGGCGGATCACG AGG (reversed) | Intergenic | ||