ID: 940502324

View in Genome Browser
Species Human (GRCh38)
Location 2:154508451-154508473
Sequence GCCGAGGCGGGCGGATCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940502324_940502332 1 Left 940502324 2:154508451-154508473 CCTCGTGATCCGCCCGCCTCGGC No data
Right 940502332 2:154508475-154508497 TCCCAAAGTACTGGGATTACAGG No data
940502324_940502330 -7 Left 940502324 2:154508451-154508473 CCTCGTGATCCGCCCGCCTCGGC No data
Right 940502330 2:154508467-154508489 CCTCGGCCTCCCAAAGTACTGGG No data
940502324_940502335 20 Left 940502324 2:154508451-154508473 CCTCGTGATCCGCCCGCCTCGGC No data
Right 940502335 2:154508494-154508516 CAGGCATGAGCCACCGTGCCCGG No data
940502324_940502328 -8 Left 940502324 2:154508451-154508473 CCTCGTGATCCGCCCGCCTCGGC No data
Right 940502328 2:154508466-154508488 GCCTCGGCCTCCCAAAGTACTGG No data
940502324_940502336 24 Left 940502324 2:154508451-154508473 CCTCGTGATCCGCCCGCCTCGGC No data
Right 940502336 2:154508498-154508520 CATGAGCCACCGTGCCCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940502324 Original CRISPR GCCGAGGCGGGCGGATCACG AGG (reversed) Intergenic