ID: 940502325

View in Genome Browser
Species Human (GRCh38)
Location 2:154508460-154508482
Sequence CTTTGGGAGGCCGAGGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940502325_940502336 15 Left 940502325 2:154508460-154508482 CCGCCCGCCTCGGCCTCCCAAAG No data
Right 940502336 2:154508498-154508520 CATGAGCCACCGTGCCCGGCCGG No data
940502325_940502332 -8 Left 940502325 2:154508460-154508482 CCGCCCGCCTCGGCCTCCCAAAG No data
Right 940502332 2:154508475-154508497 TCCCAAAGTACTGGGATTACAGG No data
940502325_940502338 23 Left 940502325 2:154508460-154508482 CCGCCCGCCTCGGCCTCCCAAAG No data
Right 940502338 2:154508506-154508528 ACCGTGCCCGGCCGGTACCTTGG No data
940502325_940502340 24 Left 940502325 2:154508460-154508482 CCGCCCGCCTCGGCCTCCCAAAG No data
Right 940502340 2:154508507-154508529 CCGTGCCCGGCCGGTACCTTGGG No data
940502325_940502335 11 Left 940502325 2:154508460-154508482 CCGCCCGCCTCGGCCTCCCAAAG No data
Right 940502335 2:154508494-154508516 CAGGCATGAGCCACCGTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940502325 Original CRISPR CTTTGGGAGGCCGAGGCGGG CGG (reversed) Intergenic