ID: 940502325

View in Genome Browser
Species Human (GRCh38)
Location 2:154508460-154508482
Sequence CTTTGGGAGGCCGAGGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 596589
Summary {0: 39056, 1: 119917, 2: 190535, 3: 147315, 4: 99766}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940502325_940502336 15 Left 940502325 2:154508460-154508482 CCGCCCGCCTCGGCCTCCCAAAG 0: 39056
1: 119917
2: 190535
3: 147315
4: 99766
Right 940502336 2:154508498-154508520 CATGAGCCACCGTGCCCGGCCGG 0: 115
1: 1009
2: 3849
3: 6107
4: 7044
940502325_940502340 24 Left 940502325 2:154508460-154508482 CCGCCCGCCTCGGCCTCCCAAAG 0: 39056
1: 119917
2: 190535
3: 147315
4: 99766
Right 940502340 2:154508507-154508529 CCGTGCCCGGCCGGTACCTTGGG No data
940502325_940502335 11 Left 940502325 2:154508460-154508482 CCGCCCGCCTCGGCCTCCCAAAG 0: 39056
1: 119917
2: 190535
3: 147315
4: 99766
Right 940502335 2:154508494-154508516 CAGGCATGAGCCACCGTGCCCGG 0: 6929
1: 41657
2: 112181
3: 156808
4: 166907
940502325_940502338 23 Left 940502325 2:154508460-154508482 CCGCCCGCCTCGGCCTCCCAAAG 0: 39056
1: 119917
2: 190535
3: 147315
4: 99766
Right 940502338 2:154508506-154508528 ACCGTGCCCGGCCGGTACCTTGG No data
940502325_940502332 -8 Left 940502325 2:154508460-154508482 CCGCCCGCCTCGGCCTCCCAAAG 0: 39056
1: 119917
2: 190535
3: 147315
4: 99766
Right 940502332 2:154508475-154508497 TCCCAAAGTACTGGGATTACAGG 0: 8025
1: 304317
2: 263755
3: 146383
4: 128484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940502325 Original CRISPR CTTTGGGAGGCCGAGGCGGG CGG (reversed) Intergenic
Too many off-targets to display for this crispr