ID: 940502326

View in Genome Browser
Species Human (GRCh38)
Location 2:154508463-154508485
Sequence GTACTTTGGGAGGCCGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 724045
Summary {0: 1938, 1: 93311, 2: 231253, 3: 239223, 4: 158320}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940502326_940502335 8 Left 940502326 2:154508463-154508485 CCCGCCTCGGCCTCCCAAAGTAC 0: 1938
1: 93311
2: 231253
3: 239223
4: 158320
Right 940502335 2:154508494-154508516 CAGGCATGAGCCACCGTGCCCGG 0: 6929
1: 41657
2: 112181
3: 156808
4: 166907
940502326_940502338 20 Left 940502326 2:154508463-154508485 CCCGCCTCGGCCTCCCAAAGTAC 0: 1938
1: 93311
2: 231253
3: 239223
4: 158320
Right 940502338 2:154508506-154508528 ACCGTGCCCGGCCGGTACCTTGG No data
940502326_940502340 21 Left 940502326 2:154508463-154508485 CCCGCCTCGGCCTCCCAAAGTAC 0: 1938
1: 93311
2: 231253
3: 239223
4: 158320
Right 940502340 2:154508507-154508529 CCGTGCCCGGCCGGTACCTTGGG No data
940502326_940502336 12 Left 940502326 2:154508463-154508485 CCCGCCTCGGCCTCCCAAAGTAC 0: 1938
1: 93311
2: 231253
3: 239223
4: 158320
Right 940502336 2:154508498-154508520 CATGAGCCACCGTGCCCGGCCGG 0: 115
1: 1009
2: 3849
3: 6107
4: 7044

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940502326 Original CRISPR GTACTTTGGGAGGCCGAGGC GGG (reversed) Intergenic
Too many off-targets to display for this crispr