ID: 940502327

View in Genome Browser
Species Human (GRCh38)
Location 2:154508464-154508486
Sequence AGTACTTTGGGAGGCCGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 497968
Summary {0: 1945, 1: 95817, 2: 190949, 3: 137757, 4: 71500}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940502327_940502340 20 Left 940502327 2:154508464-154508486 CCGCCTCGGCCTCCCAAAGTACT 0: 1945
1: 95817
2: 190949
3: 137757
4: 71500
Right 940502340 2:154508507-154508529 CCGTGCCCGGCCGGTACCTTGGG No data
940502327_940502335 7 Left 940502327 2:154508464-154508486 CCGCCTCGGCCTCCCAAAGTACT 0: 1945
1: 95817
2: 190949
3: 137757
4: 71500
Right 940502335 2:154508494-154508516 CAGGCATGAGCCACCGTGCCCGG 0: 6929
1: 41657
2: 112181
3: 156808
4: 166907
940502327_940502338 19 Left 940502327 2:154508464-154508486 CCGCCTCGGCCTCCCAAAGTACT 0: 1945
1: 95817
2: 190949
3: 137757
4: 71500
Right 940502338 2:154508506-154508528 ACCGTGCCCGGCCGGTACCTTGG No data
940502327_940502336 11 Left 940502327 2:154508464-154508486 CCGCCTCGGCCTCCCAAAGTACT 0: 1945
1: 95817
2: 190949
3: 137757
4: 71500
Right 940502336 2:154508498-154508520 CATGAGCCACCGTGCCCGGCCGG 0: 115
1: 1009
2: 3849
3: 6107
4: 7044

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940502327 Original CRISPR AGTACTTTGGGAGGCCGAGG CGG (reversed) Intergenic
Too many off-targets to display for this crispr