ID: 940502331

View in Genome Browser
Species Human (GRCh38)
Location 2:154508473-154508495
Sequence TGTAATCCCAGTACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 863823
Summary {0: 8216, 1: 308215, 2: 267713, 3: 148631, 4: 131048}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940502331_940502340 11 Left 940502331 2:154508473-154508495 CCTCCCAAAGTACTGGGATTACA 0: 8216
1: 308215
2: 267713
3: 148631
4: 131048
Right 940502340 2:154508507-154508529 CCGTGCCCGGCCGGTACCTTGGG No data
940502331_940502336 2 Left 940502331 2:154508473-154508495 CCTCCCAAAGTACTGGGATTACA 0: 8216
1: 308215
2: 267713
3: 148631
4: 131048
Right 940502336 2:154508498-154508520 CATGAGCCACCGTGCCCGGCCGG 0: 115
1: 1009
2: 3849
3: 6107
4: 7044
940502331_940502338 10 Left 940502331 2:154508473-154508495 CCTCCCAAAGTACTGGGATTACA 0: 8216
1: 308215
2: 267713
3: 148631
4: 131048
Right 940502338 2:154508506-154508528 ACCGTGCCCGGCCGGTACCTTGG No data
940502331_940502335 -2 Left 940502331 2:154508473-154508495 CCTCCCAAAGTACTGGGATTACA 0: 8216
1: 308215
2: 267713
3: 148631
4: 131048
Right 940502335 2:154508494-154508516 CAGGCATGAGCCACCGTGCCCGG 0: 6929
1: 41657
2: 112181
3: 156808
4: 166907

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940502331 Original CRISPR TGTAATCCCAGTACTTTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr