ID: 940502332

View in Genome Browser
Species Human (GRCh38)
Location 2:154508475-154508497
Sequence TCCCAAAGTACTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 850964
Summary {0: 8025, 1: 304317, 2: 263755, 3: 146383, 4: 128484}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940502325_940502332 -8 Left 940502325 2:154508460-154508482 CCGCCCGCCTCGGCCTCCCAAAG 0: 39056
1: 119917
2: 190535
3: 147315
4: 99766
Right 940502332 2:154508475-154508497 TCCCAAAGTACTGGGATTACAGG 0: 8025
1: 304317
2: 263755
3: 146383
4: 128484
940502324_940502332 1 Left 940502324 2:154508451-154508473 CCTCGTGATCCGCCCGCCTCGGC 0: 11853
1: 31231
2: 59993
3: 65789
4: 46376
Right 940502332 2:154508475-154508497 TCCCAAAGTACTGGGATTACAGG 0: 8025
1: 304317
2: 263755
3: 146383
4: 128484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940502332 Original CRISPR TCCCAAAGTACTGGGATTAC AGG Intergenic
Too many off-targets to display for this crispr