ID: 940502333

View in Genome Browser
Species Human (GRCh38)
Location 2:154508476-154508498
Sequence GCCTGTAATCCCAGTACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 838176
Summary {0: 5907, 1: 232259, 2: 277417, 3: 182413, 4: 140180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940502333_940502340 8 Left 940502333 2:154508476-154508498 CCCAAAGTACTGGGATTACAGGC 0: 5907
1: 232259
2: 277417
3: 182413
4: 140180
Right 940502340 2:154508507-154508529 CCGTGCCCGGCCGGTACCTTGGG No data
940502333_940502335 -5 Left 940502333 2:154508476-154508498 CCCAAAGTACTGGGATTACAGGC 0: 5907
1: 232259
2: 277417
3: 182413
4: 140180
Right 940502335 2:154508494-154508516 CAGGCATGAGCCACCGTGCCCGG 0: 6929
1: 41657
2: 112181
3: 156808
4: 166907
940502333_940502336 -1 Left 940502333 2:154508476-154508498 CCCAAAGTACTGGGATTACAGGC 0: 5907
1: 232259
2: 277417
3: 182413
4: 140180
Right 940502336 2:154508498-154508520 CATGAGCCACCGTGCCCGGCCGG 0: 115
1: 1009
2: 3849
3: 6107
4: 7044
940502333_940502338 7 Left 940502333 2:154508476-154508498 CCCAAAGTACTGGGATTACAGGC 0: 5907
1: 232259
2: 277417
3: 182413
4: 140180
Right 940502338 2:154508506-154508528 ACCGTGCCCGGCCGGTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940502333 Original CRISPR GCCTGTAATCCCAGTACTTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr