ID: 940502334

View in Genome Browser
Species Human (GRCh38)
Location 2:154508477-154508499
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940502334_940502338 6 Left 940502334 2:154508477-154508499 CCAAAGTACTGGGATTACAGGCA No data
Right 940502338 2:154508506-154508528 ACCGTGCCCGGCCGGTACCTTGG No data
940502334_940502335 -6 Left 940502334 2:154508477-154508499 CCAAAGTACTGGGATTACAGGCA No data
Right 940502335 2:154508494-154508516 CAGGCATGAGCCACCGTGCCCGG No data
940502334_940502336 -2 Left 940502334 2:154508477-154508499 CCAAAGTACTGGGATTACAGGCA No data
Right 940502336 2:154508498-154508520 CATGAGCCACCGTGCCCGGCCGG No data
940502334_940502340 7 Left 940502334 2:154508477-154508499 CCAAAGTACTGGGATTACAGGCA No data
Right 940502340 2:154508507-154508529 CCGTGCCCGGCCGGTACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940502334 Original CRISPR TGCCTGTAATCCCAGTACTT TGG (reversed) Intergenic