ID: 940502334

View in Genome Browser
Species Human (GRCh38)
Location 2:154508477-154508499
Sequence TGCCTGTAATCCCAGTACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 801027
Summary {0: 2978, 1: 100625, 2: 239072, 3: 244644, 4: 213708}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940502334_940502340 7 Left 940502334 2:154508477-154508499 CCAAAGTACTGGGATTACAGGCA 0: 2978
1: 100625
2: 239072
3: 244644
4: 213708
Right 940502340 2:154508507-154508529 CCGTGCCCGGCCGGTACCTTGGG No data
940502334_940502335 -6 Left 940502334 2:154508477-154508499 CCAAAGTACTGGGATTACAGGCA 0: 2978
1: 100625
2: 239072
3: 244644
4: 213708
Right 940502335 2:154508494-154508516 CAGGCATGAGCCACCGTGCCCGG 0: 6929
1: 41657
2: 112181
3: 156808
4: 166907
940502334_940502336 -2 Left 940502334 2:154508477-154508499 CCAAAGTACTGGGATTACAGGCA 0: 2978
1: 100625
2: 239072
3: 244644
4: 213708
Right 940502336 2:154508498-154508520 CATGAGCCACCGTGCCCGGCCGG 0: 115
1: 1009
2: 3849
3: 6107
4: 7044
940502334_940502338 6 Left 940502334 2:154508477-154508499 CCAAAGTACTGGGATTACAGGCA 0: 2978
1: 100625
2: 239072
3: 244644
4: 213708
Right 940502338 2:154508506-154508528 ACCGTGCCCGGCCGGTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940502334 Original CRISPR TGCCTGTAATCCCAGTACTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr