ID: 940502336

View in Genome Browser
Species Human (GRCh38)
Location 2:154508498-154508520
Sequence CATGAGCCACCGTGCCCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18124
Summary {0: 115, 1: 1009, 2: 3849, 3: 6107, 4: 7044}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940502334_940502336 -2 Left 940502334 2:154508477-154508499 CCAAAGTACTGGGATTACAGGCA 0: 2978
1: 100625
2: 239072
3: 244644
4: 213708
Right 940502336 2:154508498-154508520 CATGAGCCACCGTGCCCGGCCGG 0: 115
1: 1009
2: 3849
3: 6107
4: 7044
940502327_940502336 11 Left 940502327 2:154508464-154508486 CCGCCTCGGCCTCCCAAAGTACT 0: 1945
1: 95817
2: 190949
3: 137757
4: 71500
Right 940502336 2:154508498-154508520 CATGAGCCACCGTGCCCGGCCGG 0: 115
1: 1009
2: 3849
3: 6107
4: 7044
940502329_940502336 8 Left 940502329 2:154508467-154508489 CCTCGGCCTCCCAAAGTACTGGG 0: 2664
1: 125841
2: 272203
3: 213195
4: 126814
Right 940502336 2:154508498-154508520 CATGAGCCACCGTGCCCGGCCGG 0: 115
1: 1009
2: 3849
3: 6107
4: 7044
940502326_940502336 12 Left 940502326 2:154508463-154508485 CCCGCCTCGGCCTCCCAAAGTAC 0: 1938
1: 93311
2: 231253
3: 239223
4: 158320
Right 940502336 2:154508498-154508520 CATGAGCCACCGTGCCCGGCCGG 0: 115
1: 1009
2: 3849
3: 6107
4: 7044
940502331_940502336 2 Left 940502331 2:154508473-154508495 CCTCCCAAAGTACTGGGATTACA 0: 8216
1: 308215
2: 267713
3: 148631
4: 131048
Right 940502336 2:154508498-154508520 CATGAGCCACCGTGCCCGGCCGG 0: 115
1: 1009
2: 3849
3: 6107
4: 7044
940502324_940502336 24 Left 940502324 2:154508451-154508473 CCTCGTGATCCGCCCGCCTCGGC 0: 11853
1: 31231
2: 59993
3: 65789
4: 46376
Right 940502336 2:154508498-154508520 CATGAGCCACCGTGCCCGGCCGG 0: 115
1: 1009
2: 3849
3: 6107
4: 7044
940502325_940502336 15 Left 940502325 2:154508460-154508482 CCGCCCGCCTCGGCCTCCCAAAG 0: 39056
1: 119917
2: 190535
3: 147315
4: 99766
Right 940502336 2:154508498-154508520 CATGAGCCACCGTGCCCGGCCGG 0: 115
1: 1009
2: 3849
3: 6107
4: 7044
940502333_940502336 -1 Left 940502333 2:154508476-154508498 CCCAAAGTACTGGGATTACAGGC 0: 5907
1: 232259
2: 277417
3: 182413
4: 140180
Right 940502336 2:154508498-154508520 CATGAGCCACCGTGCCCGGCCGG 0: 115
1: 1009
2: 3849
3: 6107
4: 7044

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940502336 Original CRISPR CATGAGCCACCGTGCCCGGC CGG Intergenic
Too many off-targets to display for this crispr