ID: 940502340

View in Genome Browser
Species Human (GRCh38)
Location 2:154508507-154508529
Sequence CCGTGCCCGGCCGGTACCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940502329_940502340 17 Left 940502329 2:154508467-154508489 CCTCGGCCTCCCAAAGTACTGGG No data
Right 940502340 2:154508507-154508529 CCGTGCCCGGCCGGTACCTTGGG No data
940502334_940502340 7 Left 940502334 2:154508477-154508499 CCAAAGTACTGGGATTACAGGCA No data
Right 940502340 2:154508507-154508529 CCGTGCCCGGCCGGTACCTTGGG No data
940502325_940502340 24 Left 940502325 2:154508460-154508482 CCGCCCGCCTCGGCCTCCCAAAG No data
Right 940502340 2:154508507-154508529 CCGTGCCCGGCCGGTACCTTGGG No data
940502326_940502340 21 Left 940502326 2:154508463-154508485 CCCGCCTCGGCCTCCCAAAGTAC No data
Right 940502340 2:154508507-154508529 CCGTGCCCGGCCGGTACCTTGGG No data
940502331_940502340 11 Left 940502331 2:154508473-154508495 CCTCCCAAAGTACTGGGATTACA No data
Right 940502340 2:154508507-154508529 CCGTGCCCGGCCGGTACCTTGGG No data
940502333_940502340 8 Left 940502333 2:154508476-154508498 CCCAAAGTACTGGGATTACAGGC No data
Right 940502340 2:154508507-154508529 CCGTGCCCGGCCGGTACCTTGGG No data
940502327_940502340 20 Left 940502327 2:154508464-154508486 CCGCCTCGGCCTCCCAAAGTACT No data
Right 940502340 2:154508507-154508529 CCGTGCCCGGCCGGTACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940502340 Original CRISPR CCGTGCCCGGCCGGTACCTT GGG Intergenic