ID: 940510495

View in Genome Browser
Species Human (GRCh38)
Location 2:154607855-154607877
Sequence TACATGAGCATTAAAAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940510493_940510495 29 Left 940510493 2:154607803-154607825 CCTATCAGCAGAAAGGTGGGATT No data
Right 940510495 2:154607855-154607877 TACATGAGCATTAAAAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940510495 Original CRISPR TACATGAGCATTAAAAAAGA TGG Intergenic
No off target data available for this crispr