ID: 940510496

View in Genome Browser
Species Human (GRCh38)
Location 2:154607856-154607878
Sequence ACATGAGCATTAAAAAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940510493_940510496 30 Left 940510493 2:154607803-154607825 CCTATCAGCAGAAAGGTGGGATT No data
Right 940510496 2:154607856-154607878 ACATGAGCATTAAAAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940510496 Original CRISPR ACATGAGCATTAAAAAAGAT GGG Intergenic