ID: 940515112

View in Genome Browser
Species Human (GRCh38)
Location 2:154674173-154674195
Sequence GTTTTTTTTACCTACGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940515112_940515113 -1 Left 940515112 2:154674173-154674195 CCTGGGTCGTAGGTAAAAAAAAC No data
Right 940515113 2:154674195-154674217 CTGCTGTAGCGAAATTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940515112 Original CRISPR GTTTTTTTTACCTACGACCC AGG (reversed) Intergenic
No off target data available for this crispr