ID: 940517933

View in Genome Browser
Species Human (GRCh38)
Location 2:154704655-154704677
Sequence ATGTAGACCTAGAATTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940517933_940517941 12 Left 940517933 2:154704655-154704677 CCAATAAAATTCTAGGTCTACAT No data
Right 940517941 2:154704690-154704712 GACTACTTAAATTTTGGTCTGGG No data
940517933_940517938 6 Left 940517933 2:154704655-154704677 CCAATAAAATTCTAGGTCTACAT No data
Right 940517938 2:154704684-154704706 CCACCTGACTACTTAAATTTTGG No data
940517933_940517940 11 Left 940517933 2:154704655-154704677 CCAATAAAATTCTAGGTCTACAT No data
Right 940517940 2:154704689-154704711 TGACTACTTAAATTTTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940517933 Original CRISPR ATGTAGACCTAGAATTTTAT TGG (reversed) Intronic
No off target data available for this crispr