ID: 940525535

View in Genome Browser
Species Human (GRCh38)
Location 2:154808821-154808843
Sequence CAGGAGAAGGTGAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940525526_940525535 19 Left 940525526 2:154808779-154808801 CCATATTCTGTGACCAAATTGCC No data
Right 940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG No data
940525529_940525535 -2 Left 940525529 2:154808800-154808822 CCTTTACTAAAGTGTATGGATCA No data
Right 940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG No data
940525527_940525535 6 Left 940525527 2:154808792-154808814 CCAAATTGCCTTTACTAAAGTGT No data
Right 940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940525535 Original CRISPR CAGGAGAAGGTGAAGGAGGT GGG Intronic
No off target data available for this crispr