ID: 940527619

View in Genome Browser
Species Human (GRCh38)
Location 2:154837495-154837517
Sequence CTACTTCACCACCACTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940527619_940527623 -1 Left 940527619 2:154837495-154837517 CCTCTGGAGTGGTGGTGAAGTAG No data
Right 940527623 2:154837517-154837539 GATTGGTATAGTAATGGGAATGG No data
940527619_940527621 -7 Left 940527619 2:154837495-154837517 CCTCTGGAGTGGTGGTGAAGTAG No data
Right 940527621 2:154837511-154837533 GAAGTAGATTGGTATAGTAATGG No data
940527619_940527622 -6 Left 940527619 2:154837495-154837517 CCTCTGGAGTGGTGGTGAAGTAG No data
Right 940527622 2:154837512-154837534 AAGTAGATTGGTATAGTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940527619 Original CRISPR CTACTTCACCACCACTCCAG AGG (reversed) Intronic
No off target data available for this crispr