ID: 940545271

View in Genome Browser
Species Human (GRCh38)
Location 2:155075502-155075524
Sequence GCTGAAAGGCAGATCTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940545271_940545276 10 Left 940545271 2:155075502-155075524 CCCTCCAAGATCTGCCTTTCAGC No data
Right 940545276 2:155075535-155075557 CTGATTTGATTAGTCTGACATGG No data
940545271_940545277 16 Left 940545271 2:155075502-155075524 CCCTCCAAGATCTGCCTTTCAGC No data
Right 940545277 2:155075541-155075563 TGATTAGTCTGACATGGATCAGG No data
940545271_940545278 29 Left 940545271 2:155075502-155075524 CCCTCCAAGATCTGCCTTTCAGC No data
Right 940545278 2:155075554-155075576 ATGGATCAGGCAATCAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940545271 Original CRISPR GCTGAAAGGCAGATCTTGGA GGG (reversed) Intergenic
No off target data available for this crispr