ID: 940545974

View in Genome Browser
Species Human (GRCh38)
Location 2:155085858-155085880
Sequence ATGCAGACTCAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940545969_940545974 14 Left 940545969 2:155085821-155085843 CCGTAAGAAAGAATGAAATTTTT No data
Right 940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940545974 Original CRISPR ATGCAGACTCAGAAGGAGGA GGG Intergenic
No off target data available for this crispr