ID: 940549998

View in Genome Browser
Species Human (GRCh38)
Location 2:155141752-155141774
Sequence AGGATGGGGCTACTGTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940549998_940550007 2 Left 940549998 2:155141752-155141774 CCTACCAACAGTAGCCCCATCCT No data
Right 940550007 2:155141777-155141799 CACAGAGACTGAGAGATAAGGGG No data
940549998_940550004 0 Left 940549998 2:155141752-155141774 CCTACCAACAGTAGCCCCATCCT No data
Right 940550004 2:155141775-155141797 TCCACAGAGACTGAGAGATAAGG No data
940549998_940550006 1 Left 940549998 2:155141752-155141774 CCTACCAACAGTAGCCCCATCCT No data
Right 940550006 2:155141776-155141798 CCACAGAGACTGAGAGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940549998 Original CRISPR AGGATGGGGCTACTGTTGGT AGG (reversed) Intergenic
No off target data available for this crispr