ID: 940554262

View in Genome Browser
Species Human (GRCh38)
Location 2:155203281-155203303
Sequence CTGAGGTGCCTCAATTAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940554262_940554269 29 Left 940554262 2:155203281-155203303 CCATTCTAATTGAGGCACCTCAG No data
Right 940554269 2:155203333-155203355 AATGAGGATGTGGAAAAAAATGG No data
940554262_940554268 19 Left 940554262 2:155203281-155203303 CCATTCTAATTGAGGCACCTCAG No data
Right 940554268 2:155203323-155203345 GCTGCATGTTAATGAGGATGTGG No data
940554262_940554267 13 Left 940554262 2:155203281-155203303 CCATTCTAATTGAGGCACCTCAG No data
Right 940554267 2:155203317-155203339 AAAGATGCTGCATGTTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940554262 Original CRISPR CTGAGGTGCCTCAATTAGAA TGG (reversed) Intergenic
No off target data available for this crispr