ID: 940554268

View in Genome Browser
Species Human (GRCh38)
Location 2:155203323-155203345
Sequence GCTGCATGTTAATGAGGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940554259_940554268 30 Left 940554259 2:155203270-155203292 CCTTAAGCATCCCATTCTAATTG No data
Right 940554268 2:155203323-155203345 GCTGCATGTTAATGAGGATGTGG No data
940554264_940554268 -4 Left 940554264 2:155203304-155203326 CCAAACTTCCCTCAAAGATGCTG No data
Right 940554268 2:155203323-155203345 GCTGCATGTTAATGAGGATGTGG No data
940554263_940554268 2 Left 940554263 2:155203298-155203320 CCTCAGCCAAACTTCCCTCAAAG No data
Right 940554268 2:155203323-155203345 GCTGCATGTTAATGAGGATGTGG No data
940554262_940554268 19 Left 940554262 2:155203281-155203303 CCATTCTAATTGAGGCACCTCAG No data
Right 940554268 2:155203323-155203345 GCTGCATGTTAATGAGGATGTGG No data
940554261_940554268 20 Left 940554261 2:155203280-155203302 CCCATTCTAATTGAGGCACCTCA No data
Right 940554268 2:155203323-155203345 GCTGCATGTTAATGAGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940554268 Original CRISPR GCTGCATGTTAATGAGGATG TGG Intergenic
No off target data available for this crispr