ID: 940554269

View in Genome Browser
Species Human (GRCh38)
Location 2:155203333-155203355
Sequence AATGAGGATGTGGAAAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940554263_940554269 12 Left 940554263 2:155203298-155203320 CCTCAGCCAAACTTCCCTCAAAG No data
Right 940554269 2:155203333-155203355 AATGAGGATGTGGAAAAAAATGG No data
940554264_940554269 6 Left 940554264 2:155203304-155203326 CCAAACTTCCCTCAAAGATGCTG No data
Right 940554269 2:155203333-155203355 AATGAGGATGTGGAAAAAAATGG No data
940554262_940554269 29 Left 940554262 2:155203281-155203303 CCATTCTAATTGAGGCACCTCAG No data
Right 940554269 2:155203333-155203355 AATGAGGATGTGGAAAAAAATGG No data
940554266_940554269 -3 Left 940554266 2:155203313-155203335 CCTCAAAGATGCTGCATGTTAAT No data
Right 940554269 2:155203333-155203355 AATGAGGATGTGGAAAAAAATGG No data
940554265_940554269 -2 Left 940554265 2:155203312-155203334 CCCTCAAAGATGCTGCATGTTAA No data
Right 940554269 2:155203333-155203355 AATGAGGATGTGGAAAAAAATGG No data
940554261_940554269 30 Left 940554261 2:155203280-155203302 CCCATTCTAATTGAGGCACCTCA No data
Right 940554269 2:155203333-155203355 AATGAGGATGTGGAAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940554269 Original CRISPR AATGAGGATGTGGAAAAAAA TGG Intergenic
No off target data available for this crispr