ID: 940556338

View in Genome Browser
Species Human (GRCh38)
Location 2:155233274-155233296
Sequence GCCCACTAGGTCCTAAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940556338_940556341 -6 Left 940556338 2:155233274-155233296 CCTTTCCTTAGGACCTAGTGGGC No data
Right 940556341 2:155233291-155233313 GTGGGCCCTTTTGATCCAAAAGG No data
940556338_940556345 19 Left 940556338 2:155233274-155233296 CCTTTCCTTAGGACCTAGTGGGC No data
Right 940556345 2:155233316-155233338 TCTACTTTCTATTTGATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940556338 Original CRISPR GCCCACTAGGTCCTAAGGAA AGG (reversed) Intergenic