ID: 940556338 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:155233274-155233296 |
| Sequence | GCCCACTAGGTCCTAAGGAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940556338_940556341 | -6 | Left | 940556338 | 2:155233274-155233296 | CCTTTCCTTAGGACCTAGTGGGC | No data | ||
| Right | 940556341 | 2:155233291-155233313 | GTGGGCCCTTTTGATCCAAAAGG | No data | ||||
| 940556338_940556345 | 19 | Left | 940556338 | 2:155233274-155233296 | CCTTTCCTTAGGACCTAGTGGGC | No data | ||
| Right | 940556345 | 2:155233316-155233338 | TCTACTTTCTATTTGATTGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940556338 | Original CRISPR | GCCCACTAGGTCCTAAGGAA AGG (reversed) | Intergenic | ||