ID: 940556341

View in Genome Browser
Species Human (GRCh38)
Location 2:155233291-155233313
Sequence GTGGGCCCTTTTGATCCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940556338_940556341 -6 Left 940556338 2:155233274-155233296 CCTTTCCTTAGGACCTAGTGGGC No data
Right 940556341 2:155233291-155233313 GTGGGCCCTTTTGATCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940556341 Original CRISPR GTGGGCCCTTTTGATCCAAA AGG Intergenic
No off target data available for this crispr