ID: 940556345

View in Genome Browser
Species Human (GRCh38)
Location 2:155233316-155233338
Sequence TCTACTTTCTATTTGATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940556338_940556345 19 Left 940556338 2:155233274-155233296 CCTTTCCTTAGGACCTAGTGGGC No data
Right 940556345 2:155233316-155233338 TCTACTTTCTATTTGATTGTTGG No data
940556339_940556345 14 Left 940556339 2:155233279-155233301 CCTTAGGACCTAGTGGGCCCTTT No data
Right 940556345 2:155233316-155233338 TCTACTTTCTATTTGATTGTTGG No data
940556340_940556345 6 Left 940556340 2:155233287-155233309 CCTAGTGGGCCCTTTTGATCCAA No data
Right 940556345 2:155233316-155233338 TCTACTTTCTATTTGATTGTTGG No data
940556343_940556345 -4 Left 940556343 2:155233297-155233319 CCTTTTGATCCAAAAGGTTTCTA No data
Right 940556345 2:155233316-155233338 TCTACTTTCTATTTGATTGTTGG No data
940556342_940556345 -3 Left 940556342 2:155233296-155233318 CCCTTTTGATCCAAAAGGTTTCT No data
Right 940556345 2:155233316-155233338 TCTACTTTCTATTTGATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940556345 Original CRISPR TCTACTTTCTATTTGATTGT TGG Intergenic
No off target data available for this crispr