ID: 940561514

View in Genome Browser
Species Human (GRCh38)
Location 2:155302830-155302852
Sequence TCTCATTTTCTGTAGCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940561514_940561515 8 Left 940561514 2:155302830-155302852 CCTTCTAGCTACAGAAAATGAGA No data
Right 940561515 2:155302861-155302883 TTTTCCAGCATGCCCTGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940561514 Original CRISPR TCTCATTTTCTGTAGCTAGA AGG (reversed) Intergenic
No off target data available for this crispr