ID: 940561515 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:155302861-155302883 |
Sequence | TTTTCCAGCATGCCCTGAGT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
940561514_940561515 | 8 | Left | 940561514 | 2:155302830-155302852 | CCTTCTAGCTACAGAAAATGAGA | No data | ||
Right | 940561515 | 2:155302861-155302883 | TTTTCCAGCATGCCCTGAGTTGG | No data | ||||
940561513_940561515 | 22 | Left | 940561513 | 2:155302816-155302838 | CCAATACAAATCTGCCTTCTAGC | No data | ||
Right | 940561515 | 2:155302861-155302883 | TTTTCCAGCATGCCCTGAGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
940561515 | Original CRISPR | TTTTCCAGCATGCCCTGAGT TGG | Intergenic | ||
No off target data available for this crispr |