ID: 940561769

View in Genome Browser
Species Human (GRCh38)
Location 2:155305786-155305808
Sequence CTGTATTAGCAGCATGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940561768_940561769 -6 Left 940561768 2:155305769-155305791 CCTGGTCTGAGATATGTCTGTAT No data
Right 940561769 2:155305786-155305808 CTGTATTAGCAGCATGAGAATGG No data
940561767_940561769 7 Left 940561767 2:155305756-155305778 CCTTTATAAATTGCCTGGTCTGA No data
Right 940561769 2:155305786-155305808 CTGTATTAGCAGCATGAGAATGG No data
940561765_940561769 14 Left 940561765 2:155305749-155305771 CCTCTTTCCTTTATAAATTGCCT No data
Right 940561769 2:155305786-155305808 CTGTATTAGCAGCATGAGAATGG No data
940561764_940561769 23 Left 940561764 2:155305740-155305762 CCAATTAAACCTCTTTCCTTTAT 0: 194
1: 2224
2: 4314
3: 4000
4: 3705
Right 940561769 2:155305786-155305808 CTGTATTAGCAGCATGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940561769 Original CRISPR CTGTATTAGCAGCATGAGAA TGG Intergenic
No off target data available for this crispr