ID: 940564170

View in Genome Browser
Species Human (GRCh38)
Location 2:155339475-155339497
Sequence AAACCCTGCTTCTCAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940564165_940564170 10 Left 940564165 2:155339442-155339464 CCATTTCTACAATTCTGTGCACT No data
Right 940564170 2:155339475-155339497 AAACCCTGCTTCTCAGAGGGAGG No data
940564164_940564170 11 Left 940564164 2:155339441-155339463 CCCATTTCTACAATTCTGTGCAC No data
Right 940564170 2:155339475-155339497 AAACCCTGCTTCTCAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940564170 Original CRISPR AAACCCTGCTTCTCAGAGGG AGG Intergenic