ID: 940564255

View in Genome Browser
Species Human (GRCh38)
Location 2:155340210-155340232
Sequence CAGCTAATCTAGAGGACAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940564255_940564259 -6 Left 940564255 2:155340210-155340232 CCAGTTGTCCTCTAGATTAGCTG No data
Right 940564259 2:155340227-155340249 TAGCTGCTGCCATGGGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940564255 Original CRISPR CAGCTAATCTAGAGGACAAC TGG (reversed) Intergenic
No off target data available for this crispr