ID: 940569296 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:155409914-155409936 |
| Sequence | ACGCCCTTTTAGAAGAGTGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940569296_940569298 | 2 | Left | 940569296 | 2:155409914-155409936 | CCTTCACTCTTCTAAAAGGGCGT | No data | ||
| Right | 940569298 | 2:155409939-155409961 | TTTGTTAGGTCCATTTTCCATGG | 0: 2 1: 42 2: 38 3: 44 4: 226 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940569296 | Original CRISPR | ACGCCCTTTTAGAAGAGTGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||