ID: 940569296

View in Genome Browser
Species Human (GRCh38)
Location 2:155409914-155409936
Sequence ACGCCCTTTTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940569296_940569298 2 Left 940569296 2:155409914-155409936 CCTTCACTCTTCTAAAAGGGCGT No data
Right 940569298 2:155409939-155409961 TTTGTTAGGTCCATTTTCCATGG 0: 2
1: 42
2: 38
3: 44
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940569296 Original CRISPR ACGCCCTTTTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr