ID: 940577081

View in Genome Browser
Species Human (GRCh38)
Location 2:155522608-155522630
Sequence GAAAATGCAGCCATTTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940577077_940577081 0 Left 940577077 2:155522585-155522607 CCACATGGTAGCGTAGGAACCGG No data
Right 940577081 2:155522608-155522630 GAAAATGCAGCCATTTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940577081 Original CRISPR GAAAATGCAGCCATTTGCTG AGG Intergenic
No off target data available for this crispr