ID: 940579031

View in Genome Browser
Species Human (GRCh38)
Location 2:155551845-155551867
Sequence ATGCCCTATATGATTTACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940579031_940579033 13 Left 940579031 2:155551845-155551867 CCTCAGTAAATCATATAGGGCAT No data
Right 940579033 2:155551881-155551903 AGTCCATGTTACAAAAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940579031 Original CRISPR ATGCCCTATATGATTTACTG AGG (reversed) Intergenic
No off target data available for this crispr