ID: 940583945

View in Genome Browser
Species Human (GRCh38)
Location 2:155619157-155619179
Sequence TAGTGTGACAAGAGGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940583941_940583945 -6 Left 940583941 2:155619140-155619162 CCCTGGAATGAGGTAACTAGTGT No data
Right 940583945 2:155619157-155619179 TAGTGTGACAAGAGGGAATCAGG No data
940583942_940583945 -7 Left 940583942 2:155619141-155619163 CCTGGAATGAGGTAACTAGTGTG No data
Right 940583945 2:155619157-155619179 TAGTGTGACAAGAGGGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940583945 Original CRISPR TAGTGTGACAAGAGGGAATC AGG Intergenic
No off target data available for this crispr