ID: 940584096

View in Genome Browser
Species Human (GRCh38)
Location 2:155622202-155622224
Sequence GTAGTTCAGTGGTTCTCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940584092_940584096 29 Left 940584092 2:155622150-155622172 CCTATTGTCTCTTAAATGGATTT No data
Right 940584096 2:155622202-155622224 GTAGTTCAGTGGTTCTCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940584096 Original CRISPR GTAGTTCAGTGGTTCTCAAT AGG Intergenic
No off target data available for this crispr