ID: 940588474

View in Genome Browser
Species Human (GRCh38)
Location 2:155687165-155687187
Sequence CCCTATATGTAGGAGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940588463_940588474 18 Left 940588463 2:155687124-155687146 CCCAGTATTCTTGGCCCGCCACT No data
Right 940588474 2:155687165-155687187 CCCTATATGTAGGAGTTGGATGG No data
940588469_940588474 -5 Left 940588469 2:155687147-155687169 CCTGGAGTAGATTTCCTGCCCTA No data
Right 940588474 2:155687165-155687187 CCCTATATGTAGGAGTTGGATGG No data
940588467_940588474 3 Left 940588467 2:155687139-155687161 CCGCCACTCCTGGAGTAGATTTC No data
Right 940588474 2:155687165-155687187 CCCTATATGTAGGAGTTGGATGG No data
940588466_940588474 4 Left 940588466 2:155687138-155687160 CCCGCCACTCCTGGAGTAGATTT No data
Right 940588474 2:155687165-155687187 CCCTATATGTAGGAGTTGGATGG No data
940588464_940588474 17 Left 940588464 2:155687125-155687147 CCAGTATTCTTGGCCCGCCACTC No data
Right 940588474 2:155687165-155687187 CCCTATATGTAGGAGTTGGATGG No data
940588468_940588474 0 Left 940588468 2:155687142-155687164 CCACTCCTGGAGTAGATTTCCTG No data
Right 940588474 2:155687165-155687187 CCCTATATGTAGGAGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940588474 Original CRISPR CCCTATATGTAGGAGTTGGA TGG Intergenic
No off target data available for this crispr