ID: 940588994

View in Genome Browser
Species Human (GRCh38)
Location 2:155696824-155696846
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940588991_940588994 18 Left 940588991 2:155696783-155696805 CCTTCAAAAAGGAAGTGATACTT No data
Right 940588994 2:155696824-155696846 ACATTCCAACACAAAGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr