ID: 940590015

View in Genome Browser
Species Human (GRCh38)
Location 2:155711270-155711292
Sequence GTGTTATCACAATTGTTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940590015_940590016 -10 Left 940590015 2:155711270-155711292 CCAGGTAACAATTGTGATAACAC No data
Right 940590016 2:155711283-155711305 GTGATAACACCTGAACCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940590015 Original CRISPR GTGTTATCACAATTGTTACC TGG (reversed) Intergenic
No off target data available for this crispr