ID: 940590016

View in Genome Browser
Species Human (GRCh38)
Location 2:155711283-155711305
Sequence GTGATAACACCTGAACCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940590015_940590016 -10 Left 940590015 2:155711270-155711292 CCAGGTAACAATTGTGATAACAC No data
Right 940590016 2:155711283-155711305 GTGATAACACCTGAACCCAAAGG No data
940590011_940590016 22 Left 940590011 2:155711238-155711260 CCTAGGCCTATGTGCAGTAACAG No data
Right 940590016 2:155711283-155711305 GTGATAACACCTGAACCCAAAGG No data
940590014_940590016 -6 Left 940590014 2:155711266-155711288 CCTTCCAGGTAACAATTGTGATA No data
Right 940590016 2:155711283-155711305 GTGATAACACCTGAACCCAAAGG No data
940590012_940590016 16 Left 940590012 2:155711244-155711266 CCTATGTGCAGTAACAGTTTAAC No data
Right 940590016 2:155711283-155711305 GTGATAACACCTGAACCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940590016 Original CRISPR GTGATAACACCTGAACCCAA AGG Intergenic
No off target data available for this crispr