ID: 940592563

View in Genome Browser
Species Human (GRCh38)
Location 2:155748417-155748439
Sequence AAGAAAACTGAGCTCCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940592557_940592563 2 Left 940592557 2:155748392-155748414 CCTTCACTGTGGCTGCCAGCTGC No data
Right 940592563 2:155748417-155748439 AAGAAAACTGAGCTCCCTGGGGG No data
940592555_940592563 21 Left 940592555 2:155748373-155748395 CCTGGAAGAGGGACGGCAGCCTT No data
Right 940592563 2:155748417-155748439 AAGAAAACTGAGCTCCCTGGGGG No data
940592554_940592563 22 Left 940592554 2:155748372-155748394 CCCTGGAAGAGGGACGGCAGCCT No data
Right 940592563 2:155748417-155748439 AAGAAAACTGAGCTCCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940592563 Original CRISPR AAGAAAACTGAGCTCCCTGG GGG Intergenic