ID: 940605915

View in Genome Browser
Species Human (GRCh38)
Location 2:155924279-155924301
Sequence GACAGCTCATGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940605915_940605919 12 Left 940605915 2:155924279-155924301 CCAGTAACAGGCCATGAGCTGTC No data
Right 940605919 2:155924314-155924336 AGCAGTTATCTGCAGAAGATGGG No data
940605915_940605918 11 Left 940605915 2:155924279-155924301 CCAGTAACAGGCCATGAGCTGTC No data
Right 940605918 2:155924313-155924335 GAGCAGTTATCTGCAGAAGATGG 0: 7
1: 187
2: 197
3: 123
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940605915 Original CRISPR GACAGCTCATGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr