ID: 940610188

View in Genome Browser
Species Human (GRCh38)
Location 2:155980348-155980370
Sequence CAATGCCATGACTGCTGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940610188_940610197 30 Left 940610188 2:155980348-155980370 CCCTTGCAGCAGTCATGGCATTG No data
Right 940610197 2:155980401-155980423 ACACATCCATCTTGGCCACCAGG No data
940610188_940610194 3 Left 940610188 2:155980348-155980370 CCCTTGCAGCAGTCATGGCATTG No data
Right 940610194 2:155980374-155980396 CACCTATACAGGAATCTTCTGGG No data
940610188_940610193 2 Left 940610188 2:155980348-155980370 CCCTTGCAGCAGTCATGGCATTG No data
Right 940610193 2:155980373-155980395 CCACCTATACAGGAATCTTCTGG No data
940610188_940610196 22 Left 940610188 2:155980348-155980370 CCCTTGCAGCAGTCATGGCATTG No data
Right 940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG No data
940610188_940610190 -8 Left 940610188 2:155980348-155980370 CCCTTGCAGCAGTCATGGCATTG No data
Right 940610190 2:155980363-155980385 TGGCATTGTCCCACCTATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940610188 Original CRISPR CAATGCCATGACTGCTGCAA GGG (reversed) Intergenic
No off target data available for this crispr