ID: 940610190

View in Genome Browser
Species Human (GRCh38)
Location 2:155980363-155980385
Sequence TGGCATTGTCCCACCTATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940610186_940610190 -2 Left 940610186 2:155980342-155980364 CCAGCACCCTTGCAGCAGTCATG No data
Right 940610190 2:155980363-155980385 TGGCATTGTCCCACCTATACAGG No data
940610188_940610190 -8 Left 940610188 2:155980348-155980370 CCCTTGCAGCAGTCATGGCATTG No data
Right 940610190 2:155980363-155980385 TGGCATTGTCCCACCTATACAGG No data
940610185_940610190 10 Left 940610185 2:155980330-155980352 CCAGAGTCAGTTCCAGCACCCTT No data
Right 940610190 2:155980363-155980385 TGGCATTGTCCCACCTATACAGG No data
940610189_940610190 -9 Left 940610189 2:155980349-155980371 CCTTGCAGCAGTCATGGCATTGT No data
Right 940610190 2:155980363-155980385 TGGCATTGTCCCACCTATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940610190 Original CRISPR TGGCATTGTCCCACCTATAC AGG Intergenic
No off target data available for this crispr